Info | Home

BioPHP - Restriction digest of DNA (original)

Original code submitted by Joseba Bikandi
Code bellow is covered by GNU GPL v2 license.

Description

Last change: 2013/12/12 20:42 | Recent Changes
Restriction digestion of DNA sequences with endonucleases. Allows
restriction of one or more sequences, and also the comparison of
restriction patterns. All commercially available restriction enzymes are
included in the script.

Code

Last change: 2013/12/12 20:42 | Download original | Recent Changes | Original code and demo
<?php
// author    Joseba Bikandi
// license   GNU GPL v2
// http://www.biophp.org/minitools/restriction_digest

error_reporting(1);
// Limit the length of input text to avoid overusage of CPU
$maxtext=1000000;

// IF VENDORS FOR ENDONUCLEASES ARE REQUETED (pe. ?endo=EcoRI), RESPOND AND DIE
//   Two functions (in the bottom) are used to respond
if ($_GET["endo"]){
        // Get array of companies selling each endonuclease
        $vendors=endonuclease_vendors();
        // get array of endonucleases requested
        $endonuclease=preg_split("/,/",$_GET["endo"]);
        // start printing results
        print "<html><head><title>Vendors for ".$_GET["endo"]."</title></head>\n<body bgcolor=FFFFFF>\n";
        print "<div align=right><a href=".$_SERVER["PHP_SELF"].">Home</a></div>\n";
        if (strpos($_GET["endo"],",")>0){print "All endonucleases bellow are isoschizomers<hr>\n";}
        // print vendor for each endonuclease (uses a function)
        foreach ($endonuclease as $enzyme){
                show_vendors ($vendors[$enzyme],$enzyme);
        }
        print "</body>\n</html>";
        die(); // die
}

// IF NO DATA IS POSTED, PRINT THE FORM AND DIE
// the form is within a function
if (!$_POST){print_form(); die();}

// WHEN DATA IS POSTED, YOU WILL GET HERE
        // Obtain sequence
        $text= $_POST["sequence"];
        // apply limit
        if (strlen($text)>$maxtext){die ("Error:<br>The maximum length of input string accepted is $maxtext characters");}

        // Extract sequences, which will be stored in an array
        $sequence = extract_sequences($text);

        // Obtain the other parameters related to endonucleases
        $minimun=$_POST["minimum"];
        $retype=$_POST["retype"];
        $defined_sq=$_POST["defined"];
        $wre=$_POST["wre"];

        // We will get info for endonucleases. The info is included within 3 different functions in the bottom (for Type II, IIb and IIs enzymes)
        // Type II endonucleases are always used
        $enzymes_array=get_array_of_Type_II_endonucleases();
        // if TypeIIs endonucleases are requested, get them
        if (($_POST["IIs"]==1 and $defined_sq!=1) or $wre){$enzymes_array=array_merge ($enzymes_array,get_array_of_Type_IIs_endonucleases());asort($enzymes_array);}
        // if TypeIIb endonucleases are requested, get them
        if (($_POST["IIb"]==1 and $defined_sq!=1) or $wre){$enzymes_array=array_merge ($enzymes_array,get_array_of_Type_IIb_endonucleases());asort($enzymes_array);}


        // Remove from the list of endonucleases the ones
        // not matching the criteria in the form: $minimun, $retype and $defined_sq
        $enzymes_array=reduce_enzymes_array($enzymes_array,$minimun,$retype,$defined_sq,$wre);
        //print "<pre>";print_r($enzymes_array);
        // RESTRICTION DIGEST OF SEQUENCE
        foreach($sequence as $number =>$val){
                $digestion[$number]=restriction_digest($enzymes_array,$sequence[$number]["seq"]);
        }
        //print "<pre>";print_r($digestion);

        // START PRINTING OUT THE RESPONSE PAGE
        print "<html><head><title>Restriction enzyme digest of DNA</title></head><body bgcolor=FFFFFF><center>";

        // PRINT TABLE IN THE TOP WITH SEQUENCE
        // show sequence in the top when requested (showcode==1)
        if ($_POST["showcode"]==1){
                print "<table>";
                foreach($sequence as $key => $val){
                   $seq=$sequence[$key]["seq"];
                   if ($sequence[$key]["name"]!=""){print "<tr><td bgcolor=DDDDFF>>".$sequence[$key]["name"]."</td></tr>\n";}
                   print "<tr><td><pre><font size=2><b>Lengh of code: ".strlen($seq)."</b>\nG+C=".floor((substr_count($seq,"G")+substr_count($seq,"C"))*100/strlen($seq))."%\n\n";

                        $s=0;
                        $rtop=chunk_split($seq,10,' ');
                                while ($s<=strlen($rtop)){
                                        $rline=substr ($rtop, $s, 110);
                                        print "$rline ";
                                        $s=$s+110;
                                        if (strlen($rline)==110){print $s/1.1;}
                                        print "\n";
                                }

                   print "</font></pre></td></tr>\n";
                }
                print "</table>\n";
        }


        // OUTPUT RESTRICTION RESULTS: Start table
        print "<table><tr><td>\n";
        print "<table border=1 cellpadding=5>\n";
        print "<tr><td bgcolor=8888AA>Restriction enzyme </td>";
        if (sizeof($sequence)==1){
                print "<td bgcolor=8888AA>Cuts</td><td bgcolor=8888AA>Positions</td></tr>\n";
        }else{
                foreach ($sequence as $key => $val){
                        $counter=$key+1;
                        print "<td bgcolor=8888AA>Seq. ".$counter."</td>";
                }
        }
        print "</tr>";

        // OUTPUT RESTRICTION RESULTS: one line per restriction enzyme

        if (sizeof($sequence)==1){
            // Only one input sequence available
            foreach($digestion[0] as $enzyme => $val){
                print "\n<tr><td valign=top width=300>";
                print "<a href=".$_SERVER["PHP_SELF"]."?endo=".$enzymes_array[$enzyme][0].">".$enzymes_array[$enzyme][0]."</a> ";
                print "<pre>  ".$enzymes_array[$enzyme][1]."</pre></td>";
                if (strpos($enzyme,"#")>0){$ncuts=sizeof($digestion[0][$enzyme]["cuts"])*2;}else{$ncuts=sizeof($digestion[0][$enzyme]["cuts"]);}
                print "<td valign=top>".$ncuts."</td><td valign=top nowrap><pre>";
                foreach ($digestion[0][$enzyme]["cuts"] as $pos => $v){
                        if (strpos($enzyme,"#")>0){
                                $second_cut=$pos+$enzymes_array[$enzyme][3]-$enzymes_array[$enzyme][4];
                                print "$pos/$second_cut\n";
                        }else{
                                print "$pos\n";
                        }
                }
                print "</pre></td></tr>";
            }
        }else{
            // Two or more sequence available
            foreach($enzymes_array as $enzyme =>$val){
                $checker=0;
                if ($_POST["onlydiff"]!=1 or $wre){
                        // Show all restriction results, when endonuclease cuts at least one sequence
                        foreach($sequence as $number =>$val2){
                                if (sizeof($digestion[$number][$enzyme]["cuts"])>0){$checker=1;}
                        }
                }else{
                        // Show restriction results when they are different
                        $temp_data=sizeof($digestion[0][$enzyme]["cuts"]);
                        if ($temp_data>0){$temp_array=$digestion[0][$enzyme]["cuts"];}
                        foreach($sequence as $number =>$val2){
                                if ($number==0){continue;}
                                $temp_data2=sizeof($digestion[$number][$enzyme]["cuts"]);
                                if ($temp_data!=$temp_data2){$checker=1;break;}
                                if ($temp_data2>0){
                                        $temp_array=array_diff($temp_array,$digestion[$number][$enzyme]["cuts"]);
                                        if (sizeof($temp_array)>0){$checker=1;break;}
                                }

                        }
                }
                if ($checker==0){continue;}
                print "\n<tr><td valign=top width=300>";
                print "<a href=".$_SERVER["PHP_SELF"]."?endo=".$enzymes_array[$enzyme][0].">".$enzymes_array[$enzyme][0]."</a> ";
                print "<pre>  ".$enzymes_array[$enzyme][1]."</pre></td>";
                foreach($sequence as $number =>$val2){
                        if(!$digestion[$number][$enzyme]){print "<td>&nbsp;</td>";continue;}
                        print "<td valign=top nowrap><pre>";
                        foreach ($digestion[$number][$enzyme]["cuts"] as $pos => $nothing){
                                if (strpos($enzyme,"#")>0){
                                        $second_cut=$pos+$enzymes_array[$enzyme][3]-$enzymes_array[$enzyme][4];
                                        print "$pos/$second_cut\n";
                                }else{
                                        print "$pos\n";
                                }
                        }
                        print "&nbsp;</pre></td>";
                }
                print "</tr>";

            }
        }

        // OUTPUT RESTRICTION RESULTS: end of table
        print "</table></td></tr></table>";

//#########################################################################
//#########################     FUNCTIONS     #############################
//#########################################################################

// ################### Print form
function print_form (){
?>
    <!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN">
    <html>
    <head>
        <title>Restriction enzyme digest of DNA</title>
        <script language="JavaScript"><!--

        function Removeuseless(str) {
            str = str.split(/\d|\W/).join("");
            return str;
        }

        function strrev() {
            var str=' '+document.mydna.sequence.value.toUpperCase();
            var pos = str.indexOf('>');
            if (pos>0){return;}
            str=Removeuseless(str);
            if (!str) {document.mydna.sequence.value=''};
            var revstr=' ';
            var k=0;
            for (i = str.length-1; i>=0; i--) {
                revstr+=str.charAt(i);
                k+=1;
            };
            document.mydna.sequence.value=revstr;
            tidyup();
        }

        function tidyup() {
            var str=' '+document.mydna.sequence.value.toUpperCase();
            var pos = str.indexOf('>');
            if (pos>0){return;}
            str=Removeuseless(str);
            if (!str) {document.mydna.sequence.value=''};
            var revstr=' ';
            var k=0;
            for (i =0; i<str.length; i++) {
                revstr+=str.charAt(i);
                k+=1;
                if (k==Math.floor(k/10)*10) {revstr+=' '};
                if (k==Math.floor(k/60)*60) {revstr+=k+'\n '};
            };
            document.mydna.sequence.value=revstr;
        }

        function Complement() {
            var str=' '+document.mydna.sequence.value.toUpperCase();
            var pos = str.indexOf('>');
            if (pos>0){return};
            str=Removeuseless(str);
            str = str.split("A").join("t");
            str = str.split("T").join("a");
            str = str.split("G").join("c");
            str = str.split("C").join("g");
            str=str.toUpperCase();
            document.mydna.sequence.value=str;
            tidyup();
        };

        function source() {
            var AA=str=document.mydna.wre.selectedIndex;
            if (AA>0){
                str=document.mydna.wre.options[AA].value;
                window.document.location = "<?php print "http://".$_SERVER["HTTP_HOST"].$_SERVER["PHP_SELF"]; ?>?endo="+str;
            }

        };
        function showexample1() {
            document.mydna.sequence.value='ACGTACGTACGTTAGCTAGCTAGCTAGC';
        };
        function showexample2() {
            document.mydna.sequence.value='>seq1\nGGGGGGCCCCCC\n>seq2\nGGGGGGACCCCC';
        };

        //--></script>
    </head>
    <body text="black" bgcolor="white">
    <center>
    <table cellpadding="5">
    <tr>
   <td>
   <form method="post" name="mydna" action="<?php print $_SERVER["PHP_SELF"]; ?>">
   <b><font size="6">Restriction enzyme digest of DNA</font><br>
   <font size="4">with commercially available restriction enzymes</font></b>
   <p>
   Paste the sequence in the textbox as <a href="javascript: showexample1()">plain text</a> or <a href="javascript: showexample2()">fasta</a>.
    <br>
    <textarea rows="7" cols="75" name="sequence"> </textarea>
    <div align=right>
    <a href="javascript: tidyup ()">Tidy Up</a> &nbsp;
    <a href="javascript: strrev ()">Reverse</a> &nbsp;
    <a href="javascript: Complement ()">Complement</a>
    </div>
    <table cellpadding="5" bgcolor="#ddddff" border="1" width="100%">
    <tr><td>
    <input value="Get list of restriction enzymes" type="submit"> Show code
    <input checked="checked" value="1" name="showcode" type="checkbox">
    <br>
    Minimum recognition size for each restriction enzyme
    <select name="minimum">
    <option>1<option>2<option>3<option selected>4<option>5<option>6<option>7<option>8
    </select>
    <br>
    Type of restriction enzyme
    <select name="retype">
    <option value="0">All<option value="1">Blunt ends<option value="2">Overhang end
    </select>
    <br> Use only this endonuclease
    <select name="wre">
    <option value="">Select
    <?php
    $list="AanI,AarI,AasI,AatII,AbaSI,AbsI,AccI,AccII,AccIII,Acc16I,Acc36I,Acc65I,AccB1I,AccB7I,AccBSI,AciI,AclI,AclWI,AcoI,AcsI,AcuI,AcvI,AcyI,AdeI,AfaI,AfeI,AfiI,AflII,AflIII,AgeI,AgsI,AhdI,AhlI,AjiI,AjnI,AjuI,AleI,AlfI,AloI,AluI,AluBI,AlwI,Alw21I,Alw26I,Alw44I,AlwNI,Ama87I,Aor13HI,Aor51HI,ApaI,ApaLI,ApeKI,ApoI,ArsI,AscI,AseI,AsiGI,AsiSI,Asp700I,Asp718I,AspA2I,AspLEI,AspS9I,AssI,AsuII,AsuC2I,AsuHPI,AsuNHI,AvaI,AvaII,AvrII,AxyI,BaeI,BaeGI,BalI,BamHI,BanI,BanII,BarI,BasI,BauI,BbrPI,BbsI,BbvI,Bbv12I,BbvCI,BccI,BceAI,BcgI,BciT130I,BciVI,BclI,BcnI,BcoDI,BcuI,BfaI,BfmI,BfoI,BfrI,BfuI,BfuAI,BfuCI,BglI,BglII,BisI,BlnI,BlpI,BlsI,BmcAI,Bme18I,Bme1390I,BmeRI,BmeT110I,BmgBI,BmgT120I,BmiI,BmrI,BmrFI,BmsI,BmtI,BmuI,BoxI,BpiI,BplI,BpmI,Bpu10I,Bpu14I,Bpu1102I,BpuEI,BpuMI,BpvUI,BsaI,Bsa29I,BsaAI,BsaBI,BsaHI,BsaJI,BsaWI,BsaXI,Bsc4I,Bse1I,Bse8I,Bse21I,Bse118I,BseAI,BseBI,BseCI,BseDI,Bse3DI,BseGI,BseJI,BseLI,BseMI,BseMII,BseNI,BsePI,BseRI,BseSI,BseXI,BseX3I,BseYI,BsgI,Bsh1236I,Bsh1285I,BshFI,BshNI,BshTI,BshVI,BsiEI,BsiHKAI,BsiHKCI,BsiSI,BsiWI,BslI,BslFI,BsmI,BsmAI,BsmBI,BsmFI,BsnI,Bso31I,BsoBI,Bsp13I,Bsp19I,Bsp68I,Bsp119I,Bsp120I,Bsp143I,Bsp1286I,Bsp1407I,Bsp1720I,BspACI,BspCNI,BspDI,BspEI,BspFNI,BspHI,BspLI,BspMI,BspOI,BspPI,BspQI,BspTI,BspT104I,BspT107I,BsrI,BsrBI,BsrDI,BsrFI,BsrGI,BsrSI,BssAI,BssECI,BssHII,BssKI,BssMI,BssNI,BssNAI,BssSI,BssT1I,Bst6I,Bst1107I,BstACI,BstAFI,BstAPI,BstAUI,BstBI,Bst2BI,BstBAI,Bst4CI,BstC8I,BstDEI,BstDSI,BstEII,BstENI,BstF5I,BstFNI,BstH2I,BstHHI,BstKTI,BstMAI,BstMBI,BstMCI,BstMWI,BstNI,BstNSI,BstOI,BstPI,BstPAI,BstSCI,BstSFI,BstSLI,BstSNI,BstUI,Bst2UI,BstV1I,BstV2I,BstXI,BstX2I,BstYI,BstZI,BstZ17I,BsuI,Bsu15I,Bsu36I,BsuRI,BtgI,BtgZI,BtrI,BtsI,BtsIMutI,BtsCI,BtuMI,BveI,Cac8I,CaiI,CciI,CciNI,CfoI,Cfr9I,Cfr10I,Cfr13I,Cfr42I,ClaI,CpoI,CseI,CsiI,CspI,Csp6I,CspAI,CspCI,CviAII,CviJI,CviKI-1,CviQI,DdeI,DinI,DpnI,DpnII,DraI,DraIII,DrdI,DriI,DseDI,EaeI,EagI,Eam1104I,Eam1105I,EarI,EciI,Ecl136II,EclXI,Eco24I,Eco31I,Eco32I,Eco47I,Eco47III,Eco52I,Eco57I,Eco72I,Eco81I,Eco88I,Eco91I,Eco105I,Eco130I,Eco147I,EcoICRI,EcoNI,EcoO65I,EcoO109I,EcoP15I,EcoRI,EcoRII,EcoRV,EcoT14I,EcoT22I,EcoT38I,Eco53kI,EgeI,EheI,ErhI,Esp3I,FaeI,FaiI,FalI,FaqI,FatI,FauI,FauNDI,FbaI,FblI,Fnu4HI,FokI,FriOI,FseI,FspI,FspAI,FspBI,FspEI,Fsp4HI,GlaI,GluI,GsaI,GsuI,HaeII,HaeIII,HapII,HgaI,HhaI,Hin1I,Hin1II,Hin6I,HinP1I,HincII,HindII,HindIII,HinfI,HpaI,HpaII,HphI,Hpy8I,Hpy99I,Hpy166II,Hpy188I,Hpy188III,HpyAV,HpyCH4III,HpyCH4IV,HpyCH4V,HpyF3I,HpyF10VI,HpySE526I,Hsp92I,Hsp92II,HspAI,KasI,KflI,KpnI,Kpn2I,KroI,KspI,Ksp22I,KspAI,Kzo9I,LguI,LpnPI,Lsp1109I,LweI,MabI,MaeI,MaeII,MaeIII,MalI,MauBI,MbiI,MboI,MboII,MfeI,MflI,MhlI,MlsI,MluI,MluCI,MluNI,MlyI,Mly113I,MmeI,MnlI,Mph1103I,MreI,MroI,MroNI,MroXI,MscI,MseI,MslI,MspI,Msp20I,MspA1I,MspCI,MspJI,MspR9I,MssI,MunI,MvaI,Mva1269I,MvnI,MvrI,MwoI,NaeI,NarI,NciI,NcoI,NdeI,NdeII,NgoMIV,NheI,NlaIII,NlaIV,NmeAIII,NmuCI,NotI,NruI,NsbI,NsiI,NspI,NspV,OliI,PacI,PaeI,PaeR7I,PagI,PalAI,PasI,PauI,PceI,PciI,PciSI,PcsI,PctI,PdiI,PdmI,PfeI,Pfl23II,PflFI,PflMI,PfoI,PinAI,PleI,Ple19I,PluTI,PmaCI,PmeI,PmlI,PpsI,Ppu21I,PpuMI,PscI,PshAI,PshBI,PsiI,Psp5II,Psp6I,Psp1406I,Psp124BI,PspCI,PspEI,PspGI,PspLI,PspN4I,PspOMI,PspPI,PspPPI,PspXI,PsrI,PstI,PstNI,PsuI,PsyI,PteI,PvuI,PvuII,RgaI,RigI,RruI,RsaI,RsaNI,RseI,RsrII,Rsr2I,SacI,SacII,SalI,SapI,SaqAI,SatI,Sau96I,Sau3AI,SbfI,ScaI,SchI,ScrFI,SdaI,SduI,SetI,SexAI,SfaAI,SfaNI,SfcI,SfiI,SfoI,Sfr274I,Sfr303I,SfuI,SgeI,SgfI,SgrAI,SgrBI,SgrDI,SgsI,SlaI,SmaI,SmiI,SmiMI,SmlI,SmoI,SnaBI,SpeI,SphI,Sse9I,Sse8387I,SseBI,SsiI,SspI,SspDI,SstI,StrI,StuI,StyI,StyD4I,SwaI,TaaI,TaiI,TaqI,TaqII,TasI,TatI,TauI,TfiI,Tru1I,Tru9I,TscAI,TseI,TseFI,Tsp45I,TspDTI,TspGWI,TspMI,TspRI,Tth111I,Van91I,Vha464I,VneI,VpaK11BI,VspI,XagI,XapI,XbaI,XceI,XcmI,XhoI,XhoII,XmaI,XmaJI,XmiI,XmnI,XspI,ZraI,ZrmI,Zsp2I,";
    $list_array=preg_split("/,/",$list);
    foreach ($list_array as $n => $e){print "<option>$e\n";}
    ?>
    </select> <font size=-1><a href="javascript: source ()">Commercial source</a></font>
    <br>
    <hr> <input type=checkbox name=defined value=1>Only restriction enzymes with known bases (no N,R,Y...)
    <br> <input type=checkbox name=IIb value=1>Include Type IIb restriction enzymes (Two cleaves per recognition sequence)
    <br> <input type=checkbox name=IIs value=1>Include Type IIs restriction enzymes (Non-palindromic and cleavage outside of the recognition site)
    <hr>
    When two or more input sequences are searched:
    <br><input type=checkbox name=onlydiff value=1>Show only endonucleases showing different restriction patterns for searched sequences.
    </td></tr>
    </table>
    <font size="2">
    <br>
    Version: <b>1.20131212 </b>, based in <a href=http://rebase.neb.com>REBASE version 312</a>
    <br>
    This service recognizes 269 different cleavage patterns (from all 620 commercially available endonucleases).
    <br>
    This tool was described  by San Mill&aacute;n <i>et al</i>, 2013 (DOI: <a href=http://dx.doi.org/10.1186/1756-0500-6-513>10.1186/1756-0500-6-513</a>).
    <br>
    Copy and paste PHP script is freely available at <a href=http://www.biophp.org/minitools/restriction_digest>biophp.org</a>
    <br><a href="http://insilico.ehu.es/restriction">Restriction Home. </a>
    </font>
    </form>
    </td></tr>
    </table>
    </center>
    </body></html>
<?php
}
function reduce_enzymes_array($enzymes_array,$minimun,$retype,$defined_sq,$wre){
        // if $wre => all endonucleases but the selected one must be removed
        if ($wre){
                foreach($enzymes_array as $key => $val){
                        if (strpos(" ,".$enzymes_array[$key][0].",",$wre)>0){
                                $new_array[$wre]=$enzymes_array[$key];return $new_array;
                        }
                }
        }
        // remove endonucleases which do not match requeriments
        foreach ($enzymes_array as $enzyme => $val){
                // if retype==1 -> only Blund ends (continue for rest)
                if ($retype==1 and $enzymes_array[$enzyme][5]!=0){continue;}
                // if retype==2 -> only Overhang end (continue for rest)
                if ($retype==2 and $enzymes_array[$enzyme][5]==0){continue;}
                // Only endonucleases with which recognized in template a minimum of bases (continue for rest)
                if ($minimun>$enzymes_array[$enzyme][6]){continue;}
                // if defined sequence selected, no N (".") or "|" in pattern
                if ($defined_sq==1){
                if (strpos($enzymes_array[$enzyme][2],".")>0 or strpos($enzymes_array[$enzyme][2],"|")>0){continue;}
                }
                $enzymes_array2[$enzyme]=$enzymes_array[$enzyme];
        }
        return $enzymes_array2;
}
// ################### CALCULATE DIGESTION RESULTS
// will return an array like this
//      $digestion[$enzyme]["cuts"] - with number of cuts within the sequence
//
//
function restriction_digest($enzymes_array,$sequence){
    foreach ($enzymes_array as $enzyme => $val){
        // this is to put together results for IIb endonucleases, which are computed as "enzyme_name" and "enzyme_name@"
        $enzyme2=str_replace("@","",$enzyme);

        // split sequence based on pattern from restriction enzyme
        $fragments = preg_split("/".$enzymes_array[$enzyme][2]."/", $sequence,-1,PREG_SPLIT_DELIM_CAPTURE);
        reset ($fragments);
        $maxfragments=sizeof($fragments);
        // when sequence is cleaved ($maxfragments>1) start further calculations
        if ($maxfragments>1){
                $recognitionposition=strlen($fragments[0]);
                $counter_cleavages=0;
                $list_of_cleavages="";
                // for each frament generated, calculate cleavage position,
                //    add it to a list, and add 1 to counter
                for ($i=2;$i<$maxfragments; $i+=2){
                        $cleavageposition=$recognitionposition+$enzymes_array[$enzyme][4];
                        $digestion[$enzyme2]["cuts"][$cleavageposition]="";
                                // As overlapping may occur for many endonucleases,
                                //   a subsequence starting in position 2 of fragment is calculate
                                $subsequence=substr($fragments[$i-1],1).$fragments[$i].substr($fragments[$i+1],0,40);
                                $subsequence=substr($subsequence,0,2*$enzymes_array[$enzyme][3]-2);
                                //Previous process is repeated
                                // split subsequence based on pattern from restriction enzyme
                                $fragments_subsequence = preg_split($enzymes_array[$enzyme][2],$subsequence);
                                // when subsequence is cleaved start further calculations
                                if (sizeof($fragments_subsequence)>1){
                                        // for each fragment of subsequence, calculate overlapping cleavage position,
                                        //    add it to a list, and add 1 to counter
                                        $overlapped_cleavage=$recognitionposition+1+strlen($fragments_subsequence[0])+$enzymes_array[$enzyme][4];
                                        $digestion[$enzyme2]["cuts"][$overlapped_cleavage]="";
                                }
                        // this is a counter for position
                        $recognitionposition+=strlen($fragments[$i-1])+strlen($fragments[$i]);
                }
        }
    }
    return $digestion;
}
// Sequences in input text are transferred to an array
function extract_sequences($text){

        if (substr_count($text,">")==0){
                $sequence[0]["seq"] = preg_replace ("/\W|\d/", "", strtoupper ($text));
        }else{
                $arraysequences=preg_split("/>/", $text,-1,PREG_SPLIT_NO_EMPTY);
                $counter=0;
                foreach($arraysequences as $key =>$val){
                        $seq=substr($val,strpos($val,"\n"));
                        $seq = preg_replace ("/\W|\d/", "", strtoupper($seq));
                        if (strlen($seq)>0){
                                $sequence[$counter]["seq"] = $seq;
                                $sequence[$counter]["name"]=substr($val,0,strpos($val,"\n"));
                                $counter++;
                        }
                }
        }
        return $sequence;
}

// ################### Array of endonucleases
function get_array_of_Type_II_endonucleases(){
// this array includes all endonucleases related information required in this script
// All enzymes with the same recognition pattern are grouped
// The following information is provided for each endonuclease
//  "AasI" => array(                             First endonuclease of the list
//         0 => "AasI,DrdI,DseDI",               All endonucleases recognizing the same pattern
//         1 => "GACNN_NN'NNGTC",                Recognition pattern
//         2 => "(GAC......GTC)",                Recognition pattern for computing
//         3 => 12,                              Length of all recognition pattern
//         4 => 7,                               Cleavage position in upper strand
//         5 => -2,                              Cleavage position in lower strand, relative to previous one
//         6 => 6                                Number of non-N bases within recognition pattern
//        ),

$enzymes_array = Array(
"AasI" => array("AasI,DrdI,DseDI","GACNN_NN'NNGTC","(GAC......GTC)",12,7,-2,6),
"AatI" => array("AatI,Eco147I,PceI,SseBI,StuI","AGG'CCT","(AGGCCT)",6,3,0,6),
"AatII" => array("AatII","G_ACGT'C","(GACGTC)",6,5,-4,6),
"AbsI" => array("AbsI","CC'TCGA_GG","(CCTCGAGG)",8,6,-4,8),
"Acc16I" => array("Acc16I,AviII,FspI,NsbI","TGC'GCA","(TGCGCA)",6,3,0,6),
"Acc65I" => array("Acc65I,Asp718I","G'GTAC_C","(GGTACC)",6,1,4,6),
"AccB1I" => array("AccB1I,BanI,BshNI,BspT107I","G'GYRC_C","(GGCACC|GGCGCC|GGTACC|GGTGCC)",6,1,4,6),
"AccB7I" => array("AccB7I,BasI,PflMI,Van91I","CCAN_NNN'NTGG","(CCA.....TGG)",11,7,-3,6),
"AccBSI" => array("AccBSI,BsrBI,MbiI","CCG'CTC","(CCGCTC|GAGCGG)",6,3,0,6),
"AccI" => array("AccI,FblI,XmiI","GT'MK_AC","(GTCTAC|GTCGAC|GTATAC|GTAGAC)",6,2,2,6),
"AccII" => array("AccII,Bsh1236I,BspFNI,BstFNI,BstUI,MvnI","CG'CG","(CGCG)",4,2,0,4),
"AccIII" => array("AccIII,Aor13HI,BlfI,BseAI,Bsp13I,BspEI,Kpn2I,MroI","T'CCGG_A","(TCCGGA)",6,1,4,6),
"AciI" => array("AciI,BspACI,SsiI","C'CG_C or G'CG_G","(CCGC|GCGG)",4,1,2,4),
"AclI" => array("AclI,Psp1406I","AA'CG_TT","(AACGTT)",6,2,2,6),
"AcoI" => array("AcoI","Y'CCGG_R","(CCCGGA|CCCGGG|TCCGGA|TCCGGG)",6,1,4,6),
"AcsI" => array("AcsI,ApoI,XapI","R'AATT_Y","(AAATTC|AAATTT|GAATTC|GAATTT)",6,1,4,6),
"AcvI" => array("AcvI,BbrPI,Eco72I,PmaCI,PmlI,PspCI","CAC'GTG","(CACGTG)",6,3,0,6),
"AcyI" => array("AcyI,BsaHI,BssNI,BstACI,Hin1I,Hsp92I","GR'CG_YC","(GACGCC|GACGTC|GGCGCC|GGCGTC)",6,2,2,6),
"AdeI" => array("AdeI,DraIII","CAC_NNN'GTG","(CAC...GTG)",9,6,-3,6),
"AfaI" => array("AfaI,RsaI","GT'AC","(GTAC)",4,2,0,4),
"AfeI" => array("AfeI,Aor51HI,Eco47III","AGC'GCT","(AGCGCT)",6,3,0,6),
"AfiI" => array("AfiI,Bsc4I,BseLI,BsiYI,BslI","CCNN_NNN'NNGG","(CC.......GG)",11,7,-3,4),
"AflII" => array("AflII,BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I","C'TTAA_G","(CTTAAG)",6,1,4,6),
"AflIII" => array("AflIII","A'CRYG_T","(ACACGT|ACATGT|ACGCGT|ACGTGT)",6,1,4,6),
"AgSI" => array("AgSI","TT_S'AA","(TTGAA|TTCAA)",5,3,-1,5),
"AgeI" => array("AgeI,AsiGI,BshTI,CspAI,PinAI","A'CCGG_T","(ACCGGT)",6,1,4,6),
"AhdI" => array("AhdI,AspEI,BmeRI,DriI,Eam1105I,EclHKI","GACNN_N'NNGTC","(GAC.....GTC)",11,6,-1,6),
"AhlI" => array("AhlI,BcuI,SpeI","A'CTAG_T","(ACTAGT)",6,1,4,6),
"AjiI" => array("AjiI,BmgBI,BtrI","CAC'GTC","(CACGTC|GACGTG)",6,3,0,6),
"AjnI" => array("AjnI,EcoRII,Psp6I,PspGI","'CCWGG_","(CCAGG|CCTGG)",5,0,5,5),
"AleI" => array("AleI,OliI","CACNN'NNGTG","(CAC....GTG)",10,5,0,6),
"AluI" => array("AluI,AluBI","AG'CT","(AGCT)",4,2,0,4),
"Alw21I" => array("Alw21I,BsiHKAI,Bbv12I","G_WGCW'C","(GAGCAC|GAGCTC|GTGCAC|GTGCTC)",6,5,-4,6),
"Alw44I" => array("Alw44I,ApaLI,VneI","G'TGCA_C","(GTGCAC)",6,1,4,6),
"AlwNI" => array("AlwNI,CaiI,PstNI","CAG_NNN'CTG","(CAG...CTG)",9,6,-3,6),
"Ama87I" => array("Ama87I,AvaI,BmeT110I,BsiHKCI,BsoBI,Eco88I","C'YCGR_G","(CCCGAG|CCCGGG|CTCGAG|CTCGGG)",6,1,4,6),
"ApaI" => array("ApaI","G_GGCC'C","(GGGCCC)",6,5,-4,6),
"ApeKI" => array("ApeKI,TseI","G'CWG_C","(GCAGC|GCTGC)",5,1,3,5),
"AscI" => array("AscI,PalAI,SgsI","GG'CGCG_CC","(GGCGCGCC)",8,2,4,8),
"AseI" => array("AseI,PshBI,VspI","AT'TA_AT","(ATTAAT)",6,2,2,6),
"AsiSI" => array("AsiSI,RgaI,SfaAI,SgfI","GCG_AT'CGC","(GCGATCGC)",8,5,-2,8),
"Asp700I" => array("Asp700I,MroXI,PdmI,XmnI","GAANN'NNTTC","(GAA....TTC)",10,5,0,6),
"AspA2I" => array("AspA2I,AvrII,BlnI,XmaJI","C'CTAG_G","(CCTAGG)",6,1,4,6),
"AspI" => array("AspI,PflFI,PsyI,Tth111I","GACN'N_NGTC","(GAC...GTC)",9,4,1,6),
"AspLEI" => array("AspLEI,BstHHI,CfoI,HhaI","G_CG'C","(GCGC)",4,3,-2,4),
"AspS9I" => array("AspS9I,BmgT120I,Cfr13I,PspPI,Sau96I","G'GNC_C","(GG.CC)",5,1,3,4),
"AssI" => array("AssI,BmcAI,ScaI,ZrmI","AGT'ACT","(AGTACT)",6,3,0,6),
"AsuC2I" => array("AsuC2I,BcnI,BpuMI,NciI","CC'S_GG","(CCGGG|CCCGG)",5,2,1,5),
"AsuII" => array("AsuII,Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI","TT'CG_AA","(TTCGAA)",6,2,2,6),
"AsuNHI" => array("AsuNHI,BspOI,NheI","G'CTAG_C","(GCTAGC)",6,1,4,6),
"AvaII" => array("AvaII,Bme18I,Eco47I,SinI,VpaK11BI","G'GWC_C","(GGACC|GGTCC)",5,1,3,5),
"AxyI" => array("AxyI,Bse21I,Bsu36I,Eco81I","CC'TNA_GG","(CCT.AGG)",7,2,3,6),
"BaeGI" => array("BaeGI,BseSI,BstSLI","G_KGCM'C","(GGGCAC|GGGCCC|GTGCAC|GTGCCC)",6,5,-4,6),
"BalI" => array("BalI,MlsI,MluNI,MscI,Msp20I","TGG'CCA","(TGGCCA)",6,3,0,6),
"BamHI" => array("BamHI","G'GATC_C","(GGATCC)",6,1,4,6),
"BanII" => array("BanII,Eco24I,EcoT38I,FriOI","G_RGCY'C","(GAGCCC|GAGCTC|GGGCCC|GGGCTC)",6,5,-4,6),
"BanIII" => array("BanIII,Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,ClaI","AT'CG_AT","(ATCGAT)",6,2,2,6),
"BauI" => array("BauI","C'ACGA_G","(CACGAG)",6,1,4,6),
"BbeI" => array("BbeI,PluTI","G_GCGC'C","(GGCGCC)",6,5,-4,6),
"BbuI" => array("BbuI,PaeI,SphI","G_CATG'C","(GCATGC)",6,5,-4,6),
"BbvCI" => array("BbvCI","CC'TCA_GC or  GC'TGA_GG","(CCTCAGC|GCTGAGG)",7,2,3,7),
"BciT130I" => array("BciT130I,BseBI,BstNI,BstOI,Bst2UI,MvaI","CC'W_GG","(CCAGG|CCTGG)",5,2,1,5),
"BclI" => array("BclI,FbaI,Ksp22I","T'GATC_A","(TGATCA)",6,1,4,6),
"BfaI" => array("BfaI,FspBI,MaeI,XspI","C'TA_G","(CTAG)",4,1,2,4),
"BfmI" => array("BfmI,BpcI,BstSFI,SfcI","C'TRYA_G","(CTACAG|CTATAG|CTGCAG|CTGTAG)",6,1,4,6),
"BfoI" => array("BfoI,BstH2I,HaeII","R_GCGC'Y","(AGCGCC|AGCGCT|GGCGCC|GGCGCT)",6,5,-4,6),
"BfuCI" => array("BfuCI,Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,MboI,NdeII,Sau3AI","'GATC_","(GATC)",4,0,4,4),
"BglI" => array("BglI","GCCN_NNN'NGGC","(GCC.....GGC)",11,7,-3,6),
"BglII" => array("BglII","A'GATC_T","(AGATCT)",6,1,4,6),
"BisI" => array("BisI,BlsI,Fnu4HI,Fsp4HI,GluI,ItaI,SatI","GC'N_GC","(GC.GC)",5,2,1,4),
"BlpI" => array("BlpI,Bpu1102I,Bsp1720I,CelII","GC'TNA_GC","(GCT.AGC)",7,2,3,6),
"Bme1390I" => array("Bme1390I,MspR9I,ScrFI","CC'N_GG","(CC.GG)",5,2,1,4),
"BmiI" => array("BmiI,BspLI,NlaIV,PspN4I","GGN'NCC","(GG..CC)",6,3,0,4),
"BmrFI" => array("BmrFI,BssKI,BstSCI,StyD4I","'CCNGG_","(CC.GG)",5,0,5,4),
"BmtI" => array("BmtI","G_CTAG'C","(GCTAGC)",6,5,-4,6),
"BoxI" => array("BoxI,PshAI,BstPAI","GACNN'NNGTC","(GAC....GTC)",10,5,0,6),
"BptI" => array("BptI","CC'W_GG","(CCAGG|CCTGG)",5,2,1,5),
"Bpu10I" => array("Bpu10I","CC'TNA_GC","(CCT.AGC|GCT.AGG)",7,2,3,6),
"BpvUI" => array("BpvUI,MvrI,PvuI,Ple19I","CG_AT'CG","(CGATCG)",6,4,-2,6),
"BsaAI" => array("BsaAI,BstBAI,Ppu21I","YAC'GTR","(CACGTA|CACGTG|TACGTA|TACGTG)",6,3,0,6),
"BsaBI" => array("BsaBI,Bse8I,BseJI,MamI","GATNN'NNATC","(GAT....ATC)",10,5,0,6),
"BsaJI" => array("BsaJI,BseDI,BssECI","C'CNNG_G","(CC..GG)",6,1,4,4),
"BsaWI" => array("BsaWI","W'CCGG_W","(ACCGGA|ACCGGT|TCCGGA|TCCGGT)",6,1,4,6),
"Bse118I" => array("Bse118I,BsrFI,BssAI,Cfr10I","R'CCGG_Y","(ACCGGC|ACCGGT|GCCGGC|GCCGGT)",6,1,4,6),
"BsePI" => array("BsePI,BssHII,PauI,PteI","G'CGCG_C","(GCGCGC)",6,1,4,6),
"BseX3I" => array("BseX3I,BstZI,EagI,EclXI,Eco52I","C'GGCC_G","(CGGCCG)",6,1,4,6),
"BseYI" => array("BseYI","C'CCAG_C","(CCCAGC|GCTGGG)",6,1,4,6),
"Bsh1285I" => array("Bsh1285I,BsiEI,BstMCI","CG_RY'CG","(CGACCG|CGATCG|CGGCCG|CGGTCG)",6,4,-2,6),
"BshFI" => array("BshFI,BsnI,BspANI,BsuRI,HaeIII,PhoI","GG'CC","(GGCC)",4,2,0,4),
"BsiSI" => array("BsiSI,HapII,HpaII,MspI","C'CG_G","(CCGG)",4,1,2,4),
"BsiWI" => array("BsiWI,Pfl23II,PspLI","C'GTAC_G","(CGTACG)",6,1,4,6),
"Bsp120I" => array("Bsp120I,PspOMI","G'GGCC_C","(GGGCCC)",6,1,4,6),
"Bsp1286I" => array("Bsp1286I,MhlI,SduI","G_DGCH'C","(GAGCAC|GAGCTC|GAGCCC|GTGCAC|GTGCTC|GTGCCC|GGGCAC|GGGCTC|GGGCCC)",6,5,-4,6),
"Bsp1407I" => array("Bsp1407I,BsrGI,BstAUI,SspBI","T'GTAC_A","(TGTACA)",6,1,4,6),
"Bsp19I" => array("Bsp19I,NcoI","C'CATG_G","(CCATGG)",6,1,4,6),
"Bsp68I" => array("Bsp68I,BtuMI,NruI,RruI","TCG'CGA","(TCGCGA)",6,3,0,6),
"BspHI" => array("BspHI,CciI,PagI,RcaI","T'CATG_A","(TCATGA)",6,1,4,6),
"BspLU11I" => array("BspLU11I,PciI,PscI","A'CATG_T","(ACATGT)",6,1,4,6),
"BspMAI" => array("BspMAI,PstI","C_TGCA'G","(CTGCAG)",6,5,-4,6),
"BssNAI" => array("BssNAI,Bst1107I,BstZ17I","GTA'TAC","(GTATAC)",6,3,0,6),
"BssSI" => array("BssSI,Bst2BI","C'ACGA_G or C'TCGT_G","(CACGAG|CTCGTG)",6,1,4,6),
"BssT1I" => array("BssT1I,StyI,Eco130I,EcoT14I,ErhI","C'CWWG_G","(CCAAGG|CCATGG|CCTAGG|CCTTGG)",6,1,4,6),
"Bst4CI" => array("Bst4CI,HpyCH4III,TaaI","AC_N'GT","(AC.GT)",5,3,-1,4),
"BstAPI" => array("BstAPI","GCAN_NNN'NTGC","(GCA.....TGC)",11,7,-3,6),
"BstC8I" => array("BstC8I,Cac8I","GCN'NGC","(GC..GC)",6,3,0,4),
"BstDEI" => array("BstDEI,DdeI,HpyF3I","C'TNA_G","(CT.AG)",5,1,3,4),
"BstDSI" => array("BstDSI,BtgI","C'CRYG_G","(CCACGG|CCATGG|CCGCGG|CCGTGG)",6,1,4,6),
"BstEII" => array("BstEII,BstPI,Eco91I,EcoO65I,PspEI","G'GTNAC_C","(GGT.ACC)",7,1,5,6),
"BstENI" => array("BstENI,EcoNI,XagI","CCTNN'N_NNAGG","(CCT.....AGG)",11,5,1,6),
"BstKTI" => array("BstKTI","G_AT'C","(GATC)",4,3,2,4),
"BstMWI" => array("BstMWI,MwoI","GCNN_NNN'NNGC","(GC.......GC)",11,7,-3,4),
"BstNSI" => array("BstNSI,NspI,XceI","R_CATG'Y","(ACATGC|ACATGT|GCATGC|GCATGT)",6,5,-4,6),
"BstSNI" => array("BstSNI,Eco105I,SnaBI","TAC'GTA","(TACGTA)",6,3,0,6),
"BstX2I" => array("BstX2I,BstYI,MflI,PsuI,XhoII","R'GATC_Y","(AGATCC|AGATCT|GGATCC|GGATCT)",6,1,4,6),
"BstXI" => array("BstXI","CCAN_NNNN'NTGG","(CCA......TGG)",12,8,-4,6),
"CciNI" => array("CciNI,NotI","GC'GGCC_GC","(GCGGCCGC)",8,2,4,8),
"Cfr42I" => array("Cfr42I,KspI,SacII,Sfr303I,SgrBI,SstII","CC_GC'GG","(CCGCGG)",6,4,-2,6),
"Cfr9I" => array("Cfr9I,TspMI,XmaI,XmaCI","C'CCGG_G","(CCCGGG)",6,1,4,6),
"CfrI" => array("CfrI,EaeI","Y'GGCC_R","(CGGCCA|CGGCCG|TGGCCA|TGGCCG)",6,1,4,6),
"CpoI" => array("CpoI,CspI,RsrII,Rsr2I","CG'GWC_CG","(CGGACCG|CGGTCCG)",7,2,3,7),
"CsiI" => array("CsiI,MabI,SexAI","A'CCWGG_T","(ACCAGGT|ACCTGGT)",7,1,5,7),
"Csp6I" => array("Csp6I,CviQI,RsaNI","G'TA_C","(GTAC)",4,1,2,4),
"CviAII" => array("CviAII,FaeI,Hin1II,Hsp92II,NlaIII","_CATG'","(CATG)",4,4,-4,4),
"CviJI" => array("CviJI,CviKI-1","RG'CY","(AGCC|AGCT|GGCC|GGCT)",4,2,0,4),
"DinI" => array("DinI,Mly113I,NarI,SspDI","GG'CG_CC","(GGCGCC)",6,2,2,6),
"DpnI" => array("DpnI,MalI","GA'TC","(GATC)",4,2,0,4),
"DraI" => array("DraI","TTT'AAA","(TTTAAA)",6,3,0,6),
"Ecl136II" => array("Ecl136II,Eco53kI,EcoICRI","GAG'CTC","(GAGCTC)",6,3,0,6),
"Eco32I" => array("Eco32I,EcoRV","GAT'ATC","(GATATC)",6,3,0,6),
"EcoO109I" => array("EcoO109I,DraII","RG'GNC_CY","(AGG.CCC|AGG.CCT|GGG.CCC|GGG.CCT)",7,2,3,6),
"EcoRI" => array("EcoRI","G'AATT_C","(GAATTC)",6,1,4,6),
"EcoT22I" => array("EcoT22I,Mph1103I,NsiI,Zsp2I","A_TGCA'T","(ATGCAT)",6,5,-4,6),
"EgeI" => array("EgeI,EheI,SfoI","GGC'GCC","(GGCGCC)",6,3,0,6),
"FaiI" => array("FaiI","YA'TR","(CATA|CATG|TATA|TATG)",4,2,0,4),
"FatI" => array("FatI","'CATG_","(CATG)",4,0,4,4),
"FauNDI" => array("FauNDI,NdeI","CA'TA_TG","(CATATG)",6,2,2,6),
"FseI" => array("FseI,RigI","GG_CCGG'CC","(GGCCGGCC)",8,6,-4,8),
"FspAI" => array("FspAI","RTGC'GCAY","(ATGCGCAC|ATGCGCAT|GTGCGCAC|GTGCGCAT)",8,4,0,8),
"GlaI" => array("GlaI","GC'GC","(GCGC)",4,2,0,4),
"GsaI" => array("GsaI","C_CCAG'C","(CCCAGC|GCTGGG)",6,5,-4,6),
"Hin6I" => array("Hin6I,HinP1I,HspAI","G'CG_C","(GCGC)",4,1,2,4),
"HincII" => array("HincII,HindII","GTY'RAC","(GTCAAC|GTCGAC|GTTAAC|GTTGAC)",6,3,0,6),
"HindIII" => array("HindIII","A'AGCT_T","(AAGCTT)",6,1,4,6),
"HinfI" => array("HinfI","G'ANT_C","(GA.TC)",5,1,3,4),
"HpaI" => array("HpaI,KspAI","GTT'AAC","(GTTAAC)",6,3,0,6),
"Hpy166II" => array("Hpy166II,Hpy8I","GTN'NAC","(GT..AC)",6,3,0,4),
"Hpy188I" => array("Hpy188I","TC_N'GA","(TC.GA)",5,3,-1,4),
"Hpy188III" => array("Hpy188III","TC'NN_GA","(TC..GA)",6,2,2,4),
"Hpy99I" => array("Hpy99I","_CGWCG'","(CGACG|CGTCG)",5,5,-5,5),
"HpyCH4IV" => array("HpyCH4IV,HpySE526I,MaeII","A'CG_T","(ACGT)",4,1,2,4),
"HpyCH4V" => array("HpyCH4V","TG'CA","(TGCA)",4,2,0,4),
"HpyF10VI" => array("HpyF10VI","GCNN_NNN'NNGC","(GC.......GC)",11,7,-3,4),
"KasI" => array("KasI","G'GCGC_C","(GGCGCC)",6,1,4,6),
"KflI" => array("KflI,","GG'GWC_CC","(GGGACCC|GGGTCCC)",7,2,3,7),
"KpnI" => array("KpnI","G_GTAC'C","(GGTACC)",6,5,-4,6),
"KroI" => array("KroI,MroNI,NgoMIV","G'CCGG_C","(GCCGGC)",6,1,4,6),
"MaeIII" => array("MaeIII","'GTNAC_","(GT.AC)",5,0,5,4),
"MauBI" => array("MauBI","CG'CGCG_CG","(CGCGCGCG)",8,2,4,8),
"MfeI" => array("MfeI,MunI","C'AATT_G","(CAATTG)",6,1,4,6),
"MluCI" => array("MluCI,Sse9I,TasI,Tsp509I,TspEI","'AATT_","(AATT)",4,0,4,4),
"MluCI" => array("MluCI,Sse9I,TasI,Tsp509I,TspEI","'AATT_","(AATT)",4,0,4,4),
"MluI" => array("MluI","A'CGCG_T","(ACGCGT)",6,1,4,6),
"MreI" => array("MreI","CG'CCGG_CG","(CGCCGGCG)",8,2,4,8),
"MseI" => array("MseI,SaqAI,Tru1I,Tru9I","T'TA_A","(TTAA)",4,1,2,4),
"MslI" => array("MslI,RseI,SmiMI","CAYNN'NNRTG","(CAC....ATG|CAC....GTG|CAT....ATG|CAT....GTG)",10,5,0,6),
"MspA1I" => array("MspA1I","CMG'CKG","(CAGCGG|CAGCTG|CCGCGG|CCGCTG)",6,3,0,6),
"MssI" => array("MssI,PmeI","GTTT'AAAC","(GTTTAAAC)",8,4,0,8),
"NaeI" => array("NaeI,PdiI","GCC'GGC","(GCCGGC)",6,3,0,6),
"NmuCI" => array("NmuCI,TseFI,Tsp45I","'GTSAC_","(GTCAC|GTGAC)",5,0,5,5),
"PacI" => array("PacI","TTA_AT'TAA","(TTAATTAA)",8,5,-2,8),
"PaeR7I" => array("PaeR7I,Sfr274I,SlaI,StrI,TliI,XhoI","C'TCGA_G","(CTCGAG)",6,1,4,6),
"PasI" => array("PasI","CC'CWG_GG","(CCCAGGG|CCCTGGG)",7,2,3,7),
"PcsI" => array("PcsI","WCGNNN_N'NNNCGW","(ACG.......CGA|ACG.......CGT|TCG.......CGA|TCG.......CGT)",13,7,-1,6),
"PfeI" => array("PfeI,TfiI","G'AWT_C","(GAATC|GATTC)",5,1,3,5),
"PfoI" => array("PfoI","T'CCNGG_A","(TCC.GGA)",7,1,5,6),
"PpuMI" => array("PpuMI,Psp5II,PspPPI","RG'GWC_CY","(AGGACCC|AGGACCT|AGGTCCC|AGGTCCT|GGGACCC|GGGACCT|GGGTCCC|GGGTCCT)",7,2,3,7),
"PsiI" => array("AanI,PsiI","TTA'TAA","(TTATAA)",6,3,0,6),
"Psp124BI" => array("Psp124BI,SacI,SstI","G_AGCT'C","(GAGCTC)",6,5,-44,6),
"PspXI" => array("PspXI","VC'TCGA_GB","(ACTCGAGC|ACTCGAGG|ACTCGAGT|CCTCGAGC|CCTCGAGG|CCTCGAGT|GCTCGAGC|GCTCGAGG|GCTCGAGT)",8,2,4,8),
"PvuII" => array("PvuII","CAG'CTG","(CAGCTG)",6,3,0,6),
"SalI" => array("SalI","G'TCGA_C","(GTCGAC)",6,1,4,6),
"SbfI" => array("SbfI,SdaI,Sse8387I","CC_TGCA'GG","(CCTGCAGG)",8,6,-4,8),
"SetI" => array("SetI","_ASST'","(AGGT|AGCT|ACGT|ACCT)",4,4,-4,4),
"SfiI" => array("SfiI","GGCCN_NNN'NGGCC","(GGCC.....GGCC)",13,8,-3,8),
"SgrAI" => array("SgrAI","CR'CCGG_YG","(CACCGGCG|CACCGGTG|CGCCGGCG|CGCCGGTG)",8,2,4,8),
"SgrDI" => array("SgrDI","CG'TCGA_CG","(CGTCGACG)",8,2,4,8),
"SmaI" => array("SmaI","CCC'GGG","(CCCGGG)",6,3,0,6),
"SmiI" => array("SmiI,SwaI","ATTT'AAAT","(ATTTAAAT)",8,4,0,8),
"SmlI" => array("SmlI,SmoI","C'TYRA_G","(CTCAAG|CTCGAG|CTTAAG|CTTGAG)",6,1,4,6),
"SrfI" => array("SrfI","GCCC'GGGC","(GCCCGGGC)",8,4,0,8),
"SspI" => array("SspI","AAT'ATT","(AATATT)",6,3,0,6),
"TaiI" => array("TaiI","_ACGT'","(ACGT)",4,4,-4,4),
"TaqI" => array("TaqI","T'CG_A","(TCGA)",4,1,2,4),
"TatI" => array("TatI","W'GTAC_W","(AGTACA|AGTACT|TGTACA|TGTACT)",6,1,4,6),
"TauI" => array("TauI","G_CSG'C","(GCCGC|GCGGC)",5,4,-3,5),
"TscAI" => array("TscAI,TspRI","_NNCASTGNN'","(..CACTG..|..CAGTG..)",9,9,-9,5),
"XbaI" => array("XbaI","T'CTAG_A","(TCTAGA)",6,1,4,6),
"XcmI" => array("XcmI","CCANNNN_N'NNNNTGG","(CCA.........TGG)",15,8,-1,6),
"ZraI" => array("ZraI","GAC'GTC","(GACGTC)",6,3,0,6),
);
return $enzymes_array;
}

function get_array_of_Type_IIs_endonucleases(){
// Two lines for each endonuclease

$enzymes_array = Array(

"AarI" => array("AarI","CACCTGCNNNN'NNNN_","(CACCTGC........)",15,11,4,7),
   "AarI@" => array("","","(........GCAGGTG)",15,0,4,7),
"AbaSI" => array("AbaSI","CNNNNNNNNN_NN'","(C...........)",11,11,-2,1),
   "AbaSI@" => array("","","(...........G)",11,2,-2,1),
"Acc36I" => array("Acc36I,BfuAI,BspMI,BveI","ACCTGCNNNN'NNNN_","(ACCTGC........)",14,10,4,6),
   "Acc36I@" => array("","","(........GCAGGT)",14,0,4,6),
"AclWI" => array("AclWI,AlwI,BspPI","GGATCNNNN'N_","(GGATC.....)",10,9,1,5),
   "AclWI@" => array("","","(.....GATCC)",10,0,1,5),
"AcuI" => array("AcuI,Eco57I","CTGAAGNNNNNNNNNNNNNN_NN'","(CTGAAG................)",22,22,-2,6),
   "AcuI@" => array("","","(................CTTCAG)",22,2,-2,6),
"Alw26I" => array("Alw26I,BcoDI,BsmAI,BstMAI","GTCTCN'NNNN_","(GTCTC.....)",10,6,4,5),
   "Alw26I@" => array("","","(.....GAGAC)",10,0,4,5),
"ArsI" => array("ArsI","GACNNNNNNTTYGNNNNNN_NNNNN'","(GAC......TTCG...........|GAC......TTTG...........)",24,24,-5,7),
   "ArsI@" => array("","","(...........CGAA......GTC|...........CAAA......GTC)",24,5,-5,7),
"AsuHPI" => array("AsuHPI,HphI","GGTGANNNNNNN_N'","(GGTGA........)",13,13,-1,5),
   "AsuHPI@" => array("","","(........TCACC)",13,1,-1,5),
"BbsI" => array("BbsI,BpiI,BpuAI,BstV2I","GAAGACNN'NNNN_","(GAAGAC......)",12,8,4,6),
   "BbsI@" => array("","","(......GTCTTC)",12,0,4,6),
"BbvI" => array("BbvI,BseXI,BstV1I,Lsp1109I","GCAGCNNNNNNNN'NNNN_","(GCAGC............)",17,13,4,5),
   "BbvI@" => array("","","(............GCTGC)",17,0,4,5),
"BccI" => array("BccI","CCATCNNNN'N_","(CCATC.....)",10,9,1,5),
   "BccI@" => array("","","(.....GATGG)",10,0,1,5),
"BceAI" => array("BceAI","ACGGCNNNNNNNNNNNN'NN_","(ACGGC..............)",19,17,2,5),
   "BceAI@" => array("","","(..............GCCGT)",19,0,2,5),
"BciVI" => array("BciVI,BfuI,BsuI","GTATCCNNNNN_N'","(GTATCC......)",12,12,-1,6),
   "BciVI@" => array("","","(......GGATAC)",12,1,-1,6),
"BfiI" => array("BfiI,BmrI,BmuI","ACTGGGNNNN_N'","(ACTGGG.....)",11,11,-1,6),
   "BfiI@" => array("","","(.....CCCAGT)",11,1,-1,6),
"BmsI" => array("BmsI,LweI,SfaNI","GCATCNNNNN'NNNN_","(GCATC.........)",14,10,4,5),
   "BmsI@" => array("","","(.........GATGC)",14,0,4,5),
"BpmI" => array("BpmI,GsuI","CTGGAGNNNNNNNNNNNNNN_NN'","(CTGGAG................)",22,22,-2,6),
   "BpmI@" => array("","","(................CTCCAG)",22,2,-2,6),
"BpuEI" => array("BpuEI","CTTGAGNNNNNNNNNNNNNN_NN'","(CTTGAG................)",22,22,-2,6),
   "BpuEI@" => array("","","(................CTCAAG)",22,2,-2,6),
"BsaI" => array("BsaI,Bso31I,BspTNI,Eco31I","GGTCTCN'NNNN_","(GGTCTC.....)",11,7,4,6),
   "BsaI@" => array("","","(.....GAGACC)",11,0,4,6),
"BsaMI" => array("BsaMI,BsmI,Mva1269I,PctI","GAATG_CN'","(GAATGC.)",7,7,-2,6),
   "BsaMI@" => array("","","(.GCATTC)",7,2,-2,6),
"Bse1I" => array("Bse1I,BseNI,BsrI,BsrSI","ACTG_GN'","(ACTGG.)",6,6,-2,5),
   "Bse1I@" => array("","","(.CCAGT)",6,2,-2,5),
"Bse3DI" => array("Bse3DI,BseMI,BsrDI","GCAATG_NN'","(GCAATG..)",8,8,-2,6),
   "Bse3DI@" => array("","","(..CATTGC)",8,2,-2,6),
"BseGI" => array("BseGI,BstF5I","GGATG_NN'","(GGATG..)",7,7,-2,5),
   "BseGI@" => array("","","(..CATCC)",7,2,-2,5),
"BseMII" => array("BseMII","CTCAGNNNNNNNN_NN'","(CTCAG..........)",15,15,-2,5),
   "BseMII@" => array("","","(..........CTGAG)",15,2,-2,5),
"BseRI" => array("BseRI","GAGGAGNNNNNNNN_NN'","(GAGGAG..........)",16,16,-2,6),
   "BseRI@" => array("","","(..........CTCCTC)",16,2,-2,6),
"BsgI" => array("BsgI","GTGCAGNNNNNNNNNNNNNN_NN'","(GTGCAG................)",22,22,-2,6),
   "BsgI@" => array("","","(................CTGCAC)",22,2,-2,6),
"BslFI" => array("BslFI,FaqI","GGGACNNNNNNNNNN'NNNN_","(GGGAC..............)",19,15,4,5),
   "BslFI@" => array("","","(..............GTCCC)",19,0,4,5),
"BsmBI" => array("BsmBI,Esp3I","CGTCTCN'NNNN_","(CGTCTC.....)",11,7,4,6),
   "BsmBI@" => array("","","(.....GAGACG)",11,0,4,6),
"BsmFI" => array("BsmFI","GGGACNNNNNNNNNN'NNNN_","(GGGAC..............)",19,15,4,5),
   "BsmFI@" => array("","","(..............GTCCC)",19,0,4,5),
"BspCNI" => array("BspCNI","CTCAGNNNNNNN_NN'","(CTCAG.........)",14,14,-2,5),
   "BspCNI@" => array("","","(.........CTGAG)",14,2,-2,5),
"BspQI" => array("BspQI,LguI,PciSI,SapI","GCTCTTCN'NNN_","(GCTCTTC....)",11,8,3,7),
   "BspQI@" => array("","","(....GAAGAGC)",11,0,3,7),
"Bst6I" => array("Bst6I,Eam1104I,EarI,Ksp632I","CTCTTCN'NNN_","(CTCTTC....)",10,7,3,6),
   "Bst6I@" => array("","","(....GAAGAG)",10,0,3,6),
"BtgZI" => array("BtgZI","GCGATGNNNNNNNNNN'NNNN_","(GCGATG..............)",20,16,4,6),
   "BtgZI@" => array("","","(..............CATCGC)",20,0,4,6),
"BtsI" => array("BtsI","GCAGTG_NN'","(GCAGTG..)",8,8,-2,6),
   "BtsI@" => array("","","(..CACTGC)",8,2,-2,6),
"BtsIMutI" => array("BtsIMutI","CAGTG_NN'","(CAGTG..)",7,7,-2,5),
   "BtsIMutI@" => array("","","(..CACTG)",7,2,-2,5),
"EciI" => array("EciI","GGCGGANNNNNNNNN_NN'","(GGCGGA...........)",17,17,-2,6),
   "EciI@" => array("","","(...........TCCGCC)",17,2,-2,6),
"Eco57MI" => array("Eco57MI","CTGRAGNNNNNNNNNNNNNN_NN'","(CTGAAG................|CTGGAG................)",22,22,-2,6),
   "Eco57MI@" => array("","","(................CTCCAG|................CTTCAG)",22,2,-2,6),
"EcoP15I" => array("EcoP15I","CAGCAGNNNNNNNNNNNNNNNNNNNNNNNNN'NN_","(CAGCAG...........................)",33,31,2,6),
   "EcoP15I@" => array("","","(...........................CTGCTG)",33,0,2,6),
"FauI" => array("FauI,SmuI","CCCGCNNNN'NN_","(CCCGC......)",11,9,2,5),
   "FauI@" => array("","","(......GCGGG)",11,0,2,5),
"FokI" => array("FokI,BtsCI","GGATGNNNNNNNNN'NNNN_","(GGATG.............)",18,14,4,5),
   "FokI@" => array("","","(.............CATCC)",18,0,4,5),
"FspEI" => array("FspEI","CCNNNNNNNNNNNN'NNNN_","(CC................)",18,14,4,2),
   "FspEI@" => array("","","(................GG)",18,0,4,2),
"HgaI" => array("HgaI,CseI","GACGCNNNNN'NNNNN_","(GACGC..........)",15,10,5,5),
   "HgaI@" => array("","","(..........GCGTC)",15,0,5,5),
"HpyAV" => array("HpyAV","GCTCTTCN'NNN_","(GACGC..........)",11,11,-1,5),
   "HpyAV@" => array("","","(......GAAGG)",11,1,-1,5),
"LpnPI" => array("LpnPI","CCDGNNNNNNNNNN'NNNN_","(CCAG..............|CCGG..............|CCTG..............)",18,14,4,4),
   "LpnPI@" => array("","","(..............CTGG|..............CCGG|..............CAGG)",18,0,4,4),
"MboII" => array("MboII","GAAGANNNNNNN_N'","(GAAGA........)",13,13,-1,5),
   "MboII@" => array("","","(........TCTTC)",13,1,-1,5),
"MlyI" => array("MlyI,SchI","GAGTCNNNNN'","(GAGTC.....)",10,10,0,5),
   "MlyI@" => array("","","(.....GACTC)",10,0,0,5),
"MmeI" => array("MmeI","TCCRACNNNNNNNNNNNNNNNNNN_NN'","(TCCAAC....................|TCCGAC....................)",26,26,-2,6),
   "MmeI@" => array("","","(....................GTCGGA|....................GTTGGA)",26,2,-2,6),
"MnlI" => array("MnlI","CCTCNNNNNN_N'","(CCTC.......)",11,11,-1,4),
   "MnlI@" => array("","","(.......GAGG)",11,1,-1,4),
"MspJI" => array("MspJI","CNNRNNNNNNNNN'NNNN_","(C..A.............|C..G.............)",17,13,4,3),
   "MspJI@" => array("","","(.............T..G|.............C..G)",17,0,4,3),
"NmeAIII" => array("NmeAIII","GCCGAGNNNNNNNNNNNNNNNNNNN_NN'","(GCCGAG.....................)",27,27,-2,6),
   "NmeAIII@" => array("","","(.....................CTCGGC)",27,2,-2,6),
"PleI" => array("PleI,PpsI","GAGTCNNNN'N_","(GAGTC.....)",10,9,1,5),
   "PleI@" => array("","","(.....GACTC)",10,0,1,5),
"SgeI" => array("SgeI","CNNGNNNNNNNNN'NNNN_","(C..G.............)",17,13,4,2),
   "SgeI@" => array("","","(.............C..G)",17,0,4,2),
"TaqII" => array("TaqII","GACCGANNNNNNNNN_NN' or CACCCANNNNNNNNN_NN'","(GACCGA...........|CACCCA...........)",17,17,-2,6),
   "TaqII@" => array("","","(...........TCGGTC|...........TGGGTG)",17,2,-2,6),
"TsoI" => array("TsoI","TARCCANNNNNNNNN_NN'","(TAACCA...........|TAGCCA...........)",17,17,-2,6),
   "TsoI@" => array("","","(...........TGGTTA|...........TGGCTA)",17,2,-2,6),
"TspDTI" => array("TspDTI","ATGAANNNNNNNNN_NN'","(ATGAA...........)",16,16,-2,5),
   "TspDTI@" => array("","","(...........TTCAT)",16,2,-2,5),
"TspGWI" => array("TspGWI","ACGGANNNNNNNNN_NN'","(ACGGA...........)",16,16,-2,5),
   "TspGWI@" => array("","","(...........TCCGT)",16,2,-2,5),
);
return $enzymes_array;
}

// ################### Array of endonucleases
function get_array_of_Type_IIb_endonucleases(){

$enzymes_array = Array(
"AjuI#" => array("AjuI","_NNNNN'NNNNNNNGAANNNNNNNTTGGNNNNNN_NNNNN_'\n   Generates two cuts","(............GAA.......TTGG...........|...........CCAA.......TTC............)",37,5,-5,7),
"AlfI#" => array("AlfI","_NN'NNNNNNNNNNCGANNNNNNTGCNNNNNNNNNN_NN'\n   Generates two cuts","(............CGA......TGC............|............GCA......TCG............)",36,2,-2,6),
"AloI#" => array("AloI","_NNNNN'NNNNNNNGAACNNNNNNTCCNNNNNNN_NNNNN'\n   Generates two cuts","(............GAAC......TCC............|............GGA......GTTC............)",37,5,-5,7),
"BaeI#" => array("BaeI","_NNNNN'NNNNNNNNNNACNNNNGTAYCNNNNNNN_NNNNN'\n   Generates two cuts","(...............AC....GTACC............|...............AC....GTATC............|............GATAC....GT...............|............GGTAC....GT...............)",38,5,-5,7),
"BarI#" => array("BarI","_NNNNN'NNNNNNNGAAGNNNNNNTACNNNNNNN_NNNNN'\n   Generates two cuts","(............GAAG......TAC............|............GTA......CTTC............)",37,5,-5,7),
"BcgI#" => array("BcgI","_NN'NNNNNNNNNNCGANNNNNNTGCNNNNNNNNNN_NN'\n   Generates two cuts","(............CGA......TGC............|............GCA......TCG............)",36,2,-2,6),
"BdaI#" => array("BdaI","_NN'NNNNNNNNNNTGANNNNNNTCANNNNNNNNNN_NN'\n   Generates two cuts","(............TGA......TCA............)",36,2,-2,6),
"BplI#" => array("BplI","_NNNNN'NNNNNNNNGAGNNNNNCTCNNNNNNNN_NNNNN'\n   Generates two cuts","(.............GAG.....CTC.............|.............GAG.....CTC.............)",37,5,-5,6),
"BsaXI#" => array("BsaXI","_NNN'NNNNNNNNNACNNNNNCTCCNNNNNNN_NNN'\n   Generates two cuts","(............AC.....CTCC..........|..........GGAG.....GT............)",33,3,-3,6),
"CspCI#" => array("CspCI","_NN'NNNNNNNNNNNCAANNNNNGTGGNNNNNNNNNN_NN'\n   Generates two cuts","(.............CAA.....GTGG............|............GCA.....TCG.............)",37,2,-2,7),
"FalI#" => array("FalI","_NNNNN'NNNNNNNNAAGNNNNNCTTNNNNNNNN_NNNNN'\n   Generates two cuts","(.............AAG.....CTT.............|.............AAG.....CTT.............)",37,5,-5,6),
"Hin4I#" => array("Hin4I","_NNNNN'NNNNNNNNGAYNNNNNVTCNNNNNNNN_NNNNN'\n   Generates two cuts","(.............GAC.....ATC.............|.............GAC.....CTC.............|.............GAC.....GTC.............|.............GAT.....ATC.............|.............GAT.....CTC.............|.............GAT.....GTC.............|.............GAG.....ATC.............|.............GAG.....ATC.............)",37,5,-5,6),
"PpiI#" => array("PpiI","_NNNNN'NNNNNNNGAACNNNNNCTCNNNNNNNN_NNNNN'\n   Generates two cuts","(............GAAC.....CTC.............|.............GAG.....GTTC............)",37,5,-5,7),
"PsrI#" => array("PsrI","_NNNNN'NNNNNNNGAACNNNNNNTACNNNNNNN_NNNNN'\n   Generates two cuts","(............GAAC......TAC............|............GTA......GTTC............)",37,5,-5,7),
"TstI#" => array("TstI","_NNNNN'NNNNNNNNCACNNNNNNTCCNNNNNNN_NNNNN'\n   Generates two cuts","(.............CAC......TCC............|............GGA......GTG.............)",37,5,-5,6),
);
return $enzymes_array;
}

// This function return the list of sellers for all endonucleases included in this script
function endonuclease_vendors(){
$vendors=array(
"AanI" => "F",
"AarI" => "F",
"AasI" => "F",
"AatII" => "FIKMNR",
"AbaSI" => "N",
"AbsI" => "I",
"AccI" => "BJKMNQRSUX",
"AccII" => "JK",
"AccIII" => "JKR",
"Acc16I" => "I",
"Acc36I" => "I",
"Acc65I" => "FINR",
"AccB1I" => "I",
"AccB7I" => "I",
"AccBSI" => "I",
"AciI" => "N",
"AclI" => "IN",
"AclWI" => "I",
"AcoI" => "I",
"AcsI" => "I",
"AcuI" => "IN",
"AcvI" => "QX",
"AcyI" => "J",
"AdeI" => "F",
"AfaI" => "BK",
"AfeI" => "IN",
"AfiI" => "V",
"AflII" => "JKN",
"AflIII" => "MN",
"AgeI" => "JNR",
"AgsI" => "I",
"AhdI" => "N",
"AhlI" => "IV",
"AjiI" => "F",
"AjnI" => "I",
"AjuI" => "F",
"AleI" => "N",
"AlfI" => "F",
"AloI" => "F",
"AluI" => "BCFIJKMNOQRSUVXY",
"AluBI" => "I",
"AlwI" => "N",
"Alw21I" => "F",
"Alw26I" => "F",
"Alw44I" => "FJ",
"AlwNI" => "N",
"Ama87I" => "IV",
"Aor13HI" => "K",
"Aor51HI" => "K",
"ApaI" => "BFIJKMNQRSUVX",
"ApaLI" => "CKNU",
"ApeKI" => "N",
"ApoI" => "N",
"ArsI" => "I",
"AscI" => "N",
"AseI" => "JNO",
"AsiGI" => "IV",
"AsiSI" => "IN",
"Asp700I" => "M",
"Asp718I" => "M",
"AspA2I" => "IV",
"AspLEI" => "IV",
"AspS9I" => "IV",
"AssI" => "U",
"AsuII" => "C",
"AsuC2I" => "I",
"AsuHPI" => "IV",
"AsuNHI" => "IV",
"AvaI" => "JNQRUX",
"AvaII" => "JNRXY",
"AvrII" => "N",
"AxyI" => "J",
"BaeI" => "N",
"BaeGI" => "N",
"BalI" => "BJKQRX",
"BamHI" => "BCFIJKMNOQRSUVXY",
"BanI" => "NRU",
"BanII" => "KNX",
"BarI" => "I",
"BasI" => "U",
"BauI" => "F",
"BbrPI" => "M",
"BbsI" => "N",
"BbvI" => "N",
"Bbv12I" => "IV",
"BbvCI" => "N",
"BccI" => "N",
"BceAI" => "N",
"BcgI" => "N",
"BciT130I" => "K",
"BciVI" => "N",
"BclI" => "CFJMNORSUY",
"BcnI" => "FK",
"BcoDI" => "N",
"BcuI" => "F",
"BfaI" => "N",
"BfmI" => "F",
"BfoI" => "F",
"BfrI" => "M",
"BfuI" => "F",
"BfuAI" => "N",
"BfuCI" => "N",
"BglI" => "CFIJKNOQRUVXY",
"BglII" => "BCFIJKMNOQRSUXY",
"BisI" => "I",
"BlnI" => "KMS",
"BlpI" => "N",
"BlsI" => "I",
"BmcAI" => "V",
"Bme18I" => "IV",
"Bme1390I" => "F",
"BmeRI" => "V",
"BmeT110I" => "BK",
"BmgBI" => "N",
"BmgT120I" => "K",
"BmiI" => "V",
"BmrI" => "N",
"BmrFI" => "V",
"BmsI" => "F",
"BmtI" => "INV",
"BmuI" => "I",
"BoxI" => "F",
"BpiI" => "F",
"BplI" => "F",
"BpmI" => "IN",
"Bpu10I" => "FINV",
"Bpu14I" => "IV",
"Bpu1102I" => "FK",
"BpuEI" => "N",
"BpuMI" => "V",
"BpvUI" => "V",
"BsaI" => "N",
"Bsa29I" => "I",
"BsaAI" => "N",
"BsaBI" => "N",
"BsaHI" => "N",
"BsaJI" => "N",
"BsaWI" => "N",
"BsaXI" => "N",
"Bsc4I" => "I",
"Bse1I" => "IV",
"Bse8I" => "IV",
"Bse21I" => "IV",
"Bse118I" => "IV",
"BseAI" => "CM",
"BseBI" => "C",
"BseCI" => "C",
"BseDI" => "F",
"Bse3DI" => "IV",
"BseGI" => "F",
"BseJI" => "F",
"BseLI" => "F",
"BseMI" => "F",
"BseMII" => "F",
"BseNI" => "F",
"BsePI" => "IV",
"BseRI" => "N",
"BseSI" => "F",
"BseXI" => "F",
"BseX3I" => "IV",
"BseYI" => "N",
"BsgI" => "N",
"Bsh1236I" => "F",
"Bsh1285I" => "F",
"BshFI" => "C",
"BshNI" => "F",
"BshTI" => "BF",
"BshVI" => "V",
"BsiEI" => "N",
"BsiHKAI" => "N",
"BsiHKCI" => "QX",
"BsiSI" => "C",
"BsiWI" => "N",
"BslI" => "N",
"BslFI" => "I",
"BsmI" => "JMNS",
"BsmAI" => "N",
"BsmBI" => "N",
"BsmFI" => "N",
"BsnI" => "V",
"Bso31I" => "IV",
"BsoBI" => "N",
"Bsp13I" => "IV",
"Bsp19I" => "IV",
"Bsp68I" => "F",
"Bsp119I" => "F",
"Bsp120I" => "F",
"Bsp143I" => "F",
"Bsp1286I" => "JKN",
"Bsp1407I" => "FK",
"Bsp1720I" => "IV",
"BspACI" => "I",
"BspCNI" => "N",
"BspDI" => "N",
"BspEI" => "N",
"BspFNI" => "I",
"BspHI" => "N",
"BspLI" => "F",
"BspMI" => "N",
"BspOI" => "F",
"BspPI" => "F",
"BspQI" => "N",
"BspTI" => "F",
"BspT104I" => "K",
"BspT107I" => "K",
"BsrI" => "N",
"BsrBI" => "N",
"BsrDI" => "N",
"BsrFI" => "N",
"BsrGI" => "N",
"BsrSI" => "R",
"BssAI" => "C",
"BssECI" => "I",
"BssHII" => "JKMNQRSX",
"BssKI" => "N",
"BssMI" => "V",
"BssNI" => "V",
"BssNAI" => "IV",
"BssSI" => "N",
"BssT1I" => "IV",
"Bst6I" => "IV",
"Bst1107I" => "FK",
"BstACI" => "I",
"BstAFI" => "I",
"BstAPI" => "IN",
"BstAUI" => "IV",
"BstBI" => "N",
"Bst2BI" => "IV",
"BstBAI" => "IV",
"Bst4CI" => "IV",
"BstC8I" => "I",
"BstDEI" => "IV",
"BstDSI" => "IV",
"BstEII" => "CJNRSU",
"BstENI" => "IV",
"BstF5I" => "IV",
"BstFNI" => "IV",
"BstH2I" => "IV",
"BstHHI" => "IV",
"BstKTI" => "I",
"BstMAI" => "IV",
"BstMBI" => "IV",
"BstMCI" => "IV",
"BstMWI" => "I",
"BstNI" => "N",
"BstNSI" => "I",
"BstOI" => "R",
"BstPI" => "K",
"BstPAI" => "IV",
"BstSCI" => "I",
"BstSFI" => "I",
"BstSLI" => "I",
"BstSNI" => "IV",
"BstUI" => "N",
"Bst2UI" => "IV",
"BstV1I" => "I",
"BstV2I" => "IV",
"BstXI" => "FIJKMNQRVX",
"BstX2I" => "IV",
"BstYI" => "N",
"BstZI" => "R",
"BstZ17I" => "N",
"BsuI" => "I",
"Bsu15I" => "F",
"Bsu36I" => "NR",
"BsuRI" => "FI",
"BtgI" => "N",
"BtgZI" => "N",
"BtrI" => "I",
"BtsI" => "N",
"BtsIMutI" => "N",
"BtsCI" => "N",
"BtuMI" => "V",
"BveI" => "F",
"Cac8I" => "N",
"CaiI" => "F",
"CciI" => "I",
"CciNI" => "IV",
"CfoI" => "MRS",
"Cfr9I" => "F",
"Cfr10I" => "FK",
"Cfr13I" => "F",
"Cfr42I" => "F",
"ClaI" => "BKMNQRSUX",
"CpoI" => "FK",
"CseI" => "F",
"CsiI" => "F",
"CspI" => "R",
"Csp6I" => "F",
"CspAI" => "C",
"CspCI" => "N",
"CviAII" => "N",
"CviJI" => "QX",
"CviKI-1" => "N",
"CviQI" => "N",
"DdeI" => "KMNOQRSX",
"DinI" => "V",
"DpnI" => "BEFKMNOQRSX",
"DpnII" => "N",
"DraI" => "BFIJKMNQRSUVXY",
"DraIII" => "IMNV",
"DrdI" => "N",
"DriI" => "I",
"DseDI" => "IV",
"EaeI" => "KN",
"EagI" => "N",
"Eam1104I" => "F",
"Eam1105I" => "FK",
"EarI" => "N",
"EciI" => "N",
"Ecl136II" => "F",
"EclXI" => "MS",
"Eco24I" => "F",
"Eco31I" => "F",
"Eco32I" => "F",
"Eco47I" => "F",
"Eco47III" => "FMR",
"Eco52I" => "FK",
"Eco57I" => "F",
"Eco72I" => "F",
"Eco81I" => "FK",
"Eco88I" => "F",
"Eco91I" => "F",
"Eco105I" => "F",
"Eco130I" => "F",
"Eco147I" => "F",
"EcoICRI" => "IRV",
"EcoNI" => "N",
"EcoO65I" => "K",
"EcoO109I" => "FJKN",
"EcoP15I" => "N",
"EcoRI" => "BCFIJKMNOQRSUVXY",
"EcoRII" => "FJ",
"EcoRV" => "BCIJKMNOQRSUVXY",
"EcoT14I" => "K",
"EcoT22I" => "BK",
"EcoT38I" => "J",
"Eco53kI" => "N",
"EgeI" => "I",
"EheI" => "F",
"ErhI" => "IV",
"Esp3I" => "F",
"FaeI" => "I",
"FaiI" => "I",
"FalI" => "I",
"FaqI" => "F",
"FatI" => "IN",
"FauI" => "IN",
"FauNDI" => "IV",
"FbaI" => "K",
"FblI" => "IV",
"Fnu4HI" => "N",
"FokI" => "IJKMNVX",
"FriOI" => "IV",
"FseI" => "N",
"FspI" => "JN",
"FspAI" => "F",
"FspBI" => "F",
"FspEI" => "N",
"Fsp4HI" => "I",
"GlaI" => "I",
"GluI" => "I",
"GsaI" => "I",
"GsuI" => "F",
"HaeII" => "JKNR",
"HaeIII" => "BIJKMNOQRSUXY",
"HapII" => "BK",
"HgaI" => "IN",
"HhaI" => "BFJKNQRUXY",
"Hin1I" => "FK",
"Hin1II" => "F",
"Hin6I" => "F",
"HinP1I" => "N",
"HincII" => "BFJKNOQRUXY",
"HindII" => "IMV",
"HindIII" => "BCFIJKMNOQRSUVXY",
"HinfI" => "BCFIJKMNOQRUVXY",
"HpaI" => "BCIJKMNQRSUVX",
"HpaII" => "FINQRSUVX",
"HphI" => "FN",
"Hpy8I" => "F",
"Hpy99I" => "N",
"Hpy166II" => "N",
"Hpy188I" => "N",
"Hpy188III" => "N",
"HpyAV" => "N",
"HpyCH4III" => "N",
"HpyCH4IV" => "N",
"HpyCH4V" => "N",
"HpyF3I" => "F",
"HpyF10VI" => "F",
"HpySE526I" => "I",
"Hsp92I" => "R",
"Hsp92II" => "R",
"HspAI" => "IV",
"KasI" => "N",
"KflI" => "F",
"KpnI" => "BCFIJKMNOQRSUVXY",
"Kpn2I" => "F",
"KroI" => "I",
"KspI" => "MS",
"Ksp22I" => "IV",
"KspAI" => "F",
"Kzo9I" => "I",
"LguI" => "F",
"LpnPI" => "N",
"Lsp1109I" => "F",
"LweI" => "F",
"MabI" => "I",
"MaeI" => "M",
"MaeII" => "M",
"MaeIII" => "M",
"MalI" => "I",
"MauBI" => "F",
"MbiI" => "F",
"MboI" => "BCFKNQRUXY",
"MboII" => "FIJKNQRVX",
"MfeI" => "IN",
"MflI" => "K",
"MhlI" => "IV",
"MlsI" => "F",
"MluI" => "BFIJKMNOQRUVX",
"MluCI" => "N",
"MluNI" => "M",
"MlyI" => "N",
"Mly113I" => "I",
"MmeI" => "N",
"MnlI" => "FINQVX",
"Mph1103I" => "F",
"MreI" => "F",
"MroI" => "MO",
"MroNI" => "IV",
"MroXI" => "IV",
"MscI" => "NO",
"MseI" => "BN",
"MslI" => "N",
"MspI" => "FIJKNQRSUVXY",
"Msp20I" => "IV",
"MspA1I" => "INRV",
"MspCI" => "C",
"MspJI" => "N",
"MspR9I" => "I",
"MssI" => "F",
"MunI" => "FKM",
"MvaI" => "FMS",
"Mva1269I" => "F",
"MvnI" => "M",
"MvrI" => "U",
"MwoI" => "N",
"NaeI" => "CKNU",
"NarI" => "JMNQRUX",
"NciI" => "JNR",
"NcoI" => "BCFJKMNOQRSUXY",
"NdeI" => "BFJKMNQRSUXY",
"NdeII" => "JM",
"NgoMIV" => "N",
"NheI" => "BCFJKMNOQRSUX",
"NlaIII" => "N",
"NlaIV" => "N",
"NmeAIII" => "N",
"NmuCI" => "F",
"NotI" => "BCFJKMNOQRSUXY",
"NruI" => "BCIJKMNQRUX",
"NsbI" => "FK",
"NsiI" => "JMNQRSUX",
"NspI" => "N",
"NspV" => "J",
"OliI" => "F",
"PacI" => "FNO",
"PaeI" => "F",
"PaeR7I" => "N",
"PagI" => "F",
"PalAI" => "I",
"PasI" => "F",
"PauI" => "F",
"PceI" => "IV",
"PciI" => "IN",
"PciSI" => "I",
"PcsI" => "I",
"PctI" => "IV",
"PdiI" => "F",
"PdmI" => "F",
"PfeI" => "F",
"Pfl23II" => "F",
"PflFI" => "N",
"PflMI" => "N",
"PfoI" => "F",
"PinAI" => "MQX",
"PleI" => "N",
"Ple19I" => "I",
"PluTI" => "N",
"PmaCI" => "K",
"PmeI" => "N",
"PmlI" => "N",
"PpsI" => "I",
"Ppu21I" => "F",
"PpuMI" => "N",
"PscI" => "F",
"PshAI" => "KN",
"PshBI" => "K",
"PsiI" => "IN",
"Psp5II" => "F",
"Psp6I" => "I",
"Psp1406I" => "FK",
"Psp124BI" => "IV",
"PspCI" => "IV",
"PspEI" => "IV",
"PspGI" => "N",
"PspLI" => "I",
"PspN4I" => "I",
"PspOMI" => "INV",
"PspPI" => "C",
"PspPPI" => "I",
"PspXI" => "IN",
"PsrI" => "I",
"PstI" => "BCFIJKMNOQRSUVXY",
"PstNI" => "I",
"PsuI" => "F",
"PsyI" => "F",
"PteI" => "F",
"PvuI" => "BFKMNOQRSUXY",
"PvuII" => "BCFIJKMNOQRSUXY",
"RgaI" => "I",
"RigI" => "I",
"RruI" => "F",
"RsaI" => "CFIJMNQRSVXY",
"RsaNI" => "I",
"RseI" => "F",
"RsrII" => "NQX",
"Rsr2I" => "IV",
"SacI" => "BFJKMNOQRSUX",
"SacII" => "BJKNOQRX",
"SalI" => "BCFIJKMNOQRSUVXY",
"SapI" => "N",
"SaqAI" => "F",
"SatI" => "F",
"Sau96I" => "JNU",
"Sau3AI" => "CJKMNRSU",
"SbfI" => "INV",
"ScaI" => "BCFJKMNOQRSX",
"SchI" => "F",
"ScrFI" => "JN",
"SdaI" => "F",
"SduI" => "F",
"SetI" => "I",
"SexAI" => "MN",
"SfaAI" => "F",
"SfaNI" => "INV",
"SfcI" => "N",
"SfiI" => "CFIJKMNOQRSUVX",
"SfoI" => "N",
"Sfr274I" => "IV",
"Sfr303I" => "IV",
"SfuI" => "M",
"SgeI" => "F",
"SgfI" => "R",
"SgrAI" => "N",
"SgrBI" => "C",
"SgrDI" => "F",
"SgsI" => "F",
"SlaI" => "C",
"SmaI" => "BCFIJKMNOQRSUVXY",
"SmiI" => "FIKV",
"SmiMI" => "IV",
"SmlI" => "N",
"SmoI" => "F",
"SnaBI" => "CKMNRU",
"SpeI" => "BJKMNOQRSUX",
"SphI" => "BCIJKMNOQRSVX",
"Sse9I" => "IV",
"Sse8387I" => "K",
"SseBI" => "C",
"SsiI" => "F",
"SspI" => "BCFIJKMNQRSUVX",
"SspDI" => "F",
"SstI" => "C",
"StrI" => "U",
"StuI" => "BJKMNQRUX",
"StyI" => "CJN",
"StyD4I" => "N",
"SwaI" => "JMN",
"TaaI" => "F",
"TaiI" => "F",
"TaqI" => "BCFIJKMNQRSUVXY",
"TaqII" => "QX",
"TasI" => "F",
"TatI" => "F",
"TauI" => "F",
"TfiI" => "N",
"Tru1I" => "F",
"Tru9I" => "IMRV",
"TscAI" => "F",
"TseI" => "N",
"TseFI" => "I",
"Tsp45I" => "N",
"TspDTI" => "QX",
"TspGWI" => "QX",
"TspMI" => "N",
"TspRI" => "N",
"Tth111I" => "IKNQVX",
"Van91I" => "FK",
"Vha464I" => "V",
"VneI" => "IV",
"VpaK11BI" => "K",
"VspI" => "FIRV",
"XagI" => "F",
"XapI" => "F",
"XbaI" => "BCFIJKMNOQRSUVXY",
"XceI" => "F",
"XcmI" => "N",
"XhoI" => "BFJKMNOQRSUXY",
"XhoII" => "R",
"XmaI" => "INRUV",
"XmaJI" => "F",
"XmiI" => "F",
"XmnI" => "NRU",
"XspI" => "K",
"ZraI" => "INV",
"ZrmI" => "I",
"Zsp2I" => "IV"
);
return $vendors;

}
function show_vendors ($company,$enzyme){
        $company=" ".$company;
        print "<font size=5><b>$enzyme</b></font> <font size=-1>> <a href=http://rebase.neb.com/rebase/enz/$enzyme.html>REBASE</a></font>\n<pre>";
        if (strpos($company,"C")>0){print " <a HREF=http://www.minotech.gr>Minotech Biotechnology</a>\n";}
        if (strpos($company,"E")>0){print " <a HREF=http://www.Stratagene.com>Stratagene</a>\n";}
        if (strpos($company,"F")>0){print " <a HREF=http://www.fermentas.com/catalog/re/$re.htm>Fermentas AB</a>\n";}
        if (strpos($company,"H")>0){print " <a HREF=http://www.aablabs.com/>American Allied Biochemical, Inc.</a>\n";}
        if (strpos($company,"I")>0){print " <a HREF=http://www.sibenzyme.com>SibEnzyme Ltd.</a>\n";}
        if (strpos($company,"J")>0){print " <a HREF=http://www.nippongene.jp/>Nippon Gene Co., Ltd.</a>\n";}
        if (strpos($company,"K")>0){print " <a HREF=http://www.takarashuzo.co.jp/english/index.htm>Takara Shuzo Co. Ltd.</a>\n";}
        if (strpos($company,"M")>0){print " <a HREF=http://www.roche.com>Roche Applied Science</a>\n";}
        if (strpos($company,"N")>0){print " <a HREF=http://www.neb.com>New England Biolabs</a>\n";}
        if (strpos($company,"O")>0){print " <a HREF=http://www.toyobo.co.jp/e/>Toyobo Biochemicals</a>\n";}
        if (strpos($company,"P")>0){print " <a HREF=http://www.cvienzymes.com/>Megabase Research Products</a>\n";}
        if (strpos($company,"Q")>0){print " <a HREF=http://www.CHIMERx.com>CHIMERx</a>\n";}
        if (strpos($company,"R")>0){print " <a HREF=http://www.promega.com>Promega Corporation</a>\n";}
        if (strpos($company,"S")>0){print " <a HREF=http://www.sigmaaldrich.com/>Sigma Chemical Corporation</a>n\n";}
        if (strpos($company,"U")>0){print " <a HREF=http://www.bangaloregenei.com/>Bangalore Genei</a>\n";}
        if (strpos($company,"V")>0){print " <a HREF=http://www.mrc-holland.com>MRC-Holland</a>\n";}
        if (strpos($company,"X")>0){print " <a HREF=http://www.eurx.com.pl/index.php?op=catalog&cat=8>EURx Ltd.</a>\n";}
        print "</pre>";
}

?>
</center>
</body></html>