BioPHP - Microsatellite Repeats Finder
Original code submitted by josebaCode bellow is covered by GNU GPL v2 license.
Description
Last change: 2011/04/27 07:01 | Edit description | Recent Changes | Original descriptionFinds microsatellites in DNA sequences. Microsatellites are copies of simple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.
Code
Last change: 2011/04/27 07:01 | Edit Code | Recent Changes | Download | Original code and<!--
Title: Microsatellites Script
Author: Joseba Bikandi
-->
<html><head>
<title>Find tandem repeats</title>
</head>
<body bgcolor=FFFFFF>
<h1>Microsatellite repeats finder</h1>
<form method="POST" action=""<? print $_SERVER["PHP_SELF"]; ?>"">
<b>Sequence</b>:<br>
<TEXTAREA name=sequence cols="75" rows="10">AACAATGCCATGATGATGATTATTACGACACAACAACACCGCGCTTGACGGCGGCGGATGGATGCCG
CGATCAGACGTTCAACGCCCACGTAACGTAACGCAACGTAACCTAACGACACTGTTAACGGTACGAT
</TEXTAREA>
<br>Length of repeated sequence: Minimum:<select name=min><option selected>2<option>3<option>4<option>5<option>6</select>
Maximum:<select name=max><option>3<option>4<option>5<option selected>6<option>7<option>8<option>9<option>10</select>
<br>Minimum number of repeats: <select name=min_repeats><option>2<option selected>3<option>4<option>5<option>6</select>
<br>Minimum length of tanden repeat: <select name=length_of_MR><option>5<option selected>6<option>7<option>8<option>9<option>10<option>11<option>12<option>13<option>14<option>15<option>16<option>17<option>18<option>19<option>20</select></select></select>
<br>Allowed percentaje of mismatches: <select name=mismatch><option selected>0<option>0.1<option>0.2<option>0.3</select>
<br><input type=submit value="Find Microsatellite repeats">
</form>
<p>
<?php
// IF NO DATA POSTED, DIE
if($_POST){
// Get the sequence
$sequence=strtoupper($_POST["sequence"]);
// Remove non word and digits from sequence
$sequence=preg_replace("/\W|\d/","",$sequence);
// Get paramethers
$min_length=$_POST["min"];
$max_length=$_POST["max"];
$min_repeats=$_POST["min_repeats"];
$min_length_of_MR=$_POST["length_of_MR"];
$mismatches_allowed=$_POST["mismatch"];
//Find microsatellite repeats (uses a function)
$results=find_microsatellite_repeats ($sequence,$min_length,$max_length,$min_repeats,$min_length_of_MR,$mismatches_allowed);
// Print results
print "<table cellpadding=4>";
print "<tr><td bgcolor=AAAAAFF>Posición</td><td bgcolor=AAAAAFF>Cicle</td><td bgcolor=AAAAAFF>Repeats</td><td bgcolor=AAAAAFF>Sequence</td></tr>\n";
foreach ($results as $key => $val){
print "<tr>";
print "<td>".$results[$key]["start_position"]."</td>";
print "<td>".$results[$key]["length"]."</td>";
print "<td>".$results[$key]["repeats"]."</td>";
print "<td>".$results[$key]["sequence"]."</td>\n";
print "</tr>";
}
print "</table>";
}
// Description for Function find_microsatellite_repeats
// This function will search for microsatellite repeats within a sequence. A microsatellite repeat is defined as a sequence
// which shows a repeated pattern, as for example in sequence 'ACGTACGTACGTACGT', where 'ACGT' is repeated
// 4 times. The function allows searching for this kind of subsequences within a sequence.
//
// Parameters
// $sequence is the sequence
// $min_length and $max_length are the range of oligo lengths to be searched; p.e. oligos with length 2 to 6
// $min_repeats is the minimal number of time a sequence must be repeated to be considered as a microsatellite repeat
// $min_length_of_MR minimum length of tanden repeat; to avoid considering AAAA as a microsatellite repeat, set it to >4
// $mismatches_allowed is the porcentaje of errors allowed when searching in the repetitive sequence
// so that sequence AACCGGTT-AAGCGGTT-AACCGGAT-AACCGGTT may be considered as a microsatellite repeat
//
// Return
// The function will return an array with the following structure:
// $results=Array(
// 0=>Array(
// start_position => 10,
// length => 4,
// repeats => 4,
// sequence => ACGTACGTACGTACGT,
// ),
// 0=>Array(
// start_position => 50,
// length => 3,
// repeats => 3,
// sequence => ATCATCATC,
// ),
// );
//
// Requeriments:
// Functions IncludeN_1, IncludeN_2 and IncludeN_3
function find_microsatellite_repeats($sequence,$min_length,$max_length,$min_repeats,$min_length_of_MR,$mismatches_allowed){
$len_seq=strlen($sequence);
$counter=0;
for ($i=0;$i<$len_seq-3;$i++){
for ($j=$min_length;$j<$max_length+1;$j++){
if (($i+$j)>$len_seq){break;}
$sub_seq=substr($sequence,$i,$j);
$len_sub_seq=strlen ($sub_seq);
$mismatches=floor($len_sub_seq*$mismatches_allowed);
if ($mismatches==1){$sub_seq_pattern=includeN_1($sub_seq,0);}
elseif ($mismatches==2){$sub_seq_pattern=includeN_2($sub_seq,0);}
elseif ($mismatches==3){$sub_seq_pattern=includeN_3($sub_seq,0);}
else {$sub_seq_pattern=$sub_seq;}
$matches=1;
while (preg_match_all("/($sub_seq_pattern)/",substr($sequence,($i+$j*$matches),$j),$out)==1){$matches++;}
if ($matches>=$min_repeats and ($j*$matches)>=$min_length_of_MR){
$results[$counter]["start_position"]=$i;
$results[$counter]["length"]=$j;
$results[$counter]["repeats"]=$matches;
$results[$counter]["sequence"]=substr($sequence,$i,$j*$matches);
$counter++;
$i+=$j*$matches;
}
}
}
return ($results);
}
// Description for Function IncludeN_1
// When a DNA sequence ("$primer") is provided to this function, as for example "acgt", this function will return
// a pattern like ".cgt|a.gt|ac.t|acg.". This pattern may be useful to find within a DNA sequence
// subsequences matching $primer, but allowing one missmach. The parameter $minus
// is a numeric value which indicates number of bases always maching the DNA sequence in 3' end.
// For example, when $minus is 1, the pattern for "acgt" will be ".cgt|a.gt|ac.t".
// Check also IncludeN_2 and IncludeN_3.
//
// Parameters
// $primer is a DNA sequence (oligonucleotide, primer)
// $minus indicates number of bases in 3' which will always much the DNA sequence.
//
// Return
// Returns a pattern (as described in "Description").
function includeN_1($primer,$minus) {
$code=".".substr($primer,1);
$wpos=1;
while ($wpos<strlen($primer)-$minus){
$code.="|".substr($primer,0,$wpos).".".substr($primer,$wpos+1);
$wpos++;
}
return ($code);
}
// Description for Function IncludeN_2
// Similar to function IncludeN_1. When a DNA sequence ("$primer") is provided to this function, as for example "acgt",
// this function will return a pattern like "..gt|.c.t|.cg.|a..t|a.g.|ac..". This pattern may be useful to find within
// a DNA sequence subsequences matching $primer, but allowing two missmaches. The parameter $minus
// is a numeric value which indicates number of bases always maching the DNA sequence in 3' end.
// For example, when $minus is 1, the pattern for "acgt" will be "..gt|.c.t|a..t".
// Check also IncludeN_1 and IncludeN_3.
//
// Parameters
// $primer is a DNA sequence (oligonucleotide, primer)
// $minus indicates number of bases in 3' which will always much the DNA sequence.
//
// Return
// Returns a pattern (as described in "Description").
function includeN_2($primer,$minus) {
$max=strlen($primer)-$minus;
$code="";
for($i=0;$i<$max;$i++){
for($j=0;$j<$max-$i-1;$j++){
$code.="|".substr($primer,0,$i).".";
$resto=substr($primer,$i+1);
$code.=substr($resto,0,$j).".".substr($resto,$j+1);
}
}
$code=substr($code,1);
return ($code);
}
// Description for Function IncludeN_3
// Similar to function IncludeN_1 and IncludeN_2, but allows two missmaches. The parameter $minus
// is a numeric value which indicates number of bases always maching the DNA sequence in 3' end.
//
// Parameters
// $primer is a DNA sequence (oligonucleotide, primer)
// $minus indicates number of bases in 3' which will always much the DNA sequence.
//
// Return
// Returns a pattern (as described in "Description").
function includeN_3($primer,$minus) {
$max=strlen($primer)-$minus;
$code="";
for($i=0;$i<$max;$i++){
for($j=0;$j<$max-$i-1;$j++){
$code.="|".substr($primer,0,$i).".";
$resto=substr($primer,$i+1);
$code.=substr($resto,0,$j).".".substr($resto,$j+1);
}
}
$code=substr($code,1);
return ($code);
}
?>
<hr>
<font size=+1><b><u>Definitions</u></b></font>
<br><b>Microsatellite Repeat</b>:
<br>A variety of simple di- (DINUCLEOTIDE REPEATS), tri- (TRINUCLEOTIDE REPEATS), tetra-, and pentanucleotide tandem repeats (usually less than 100 bases long).
<p><b>Tandem repeats</b>:
<br>Copies of DNA sequences which lie adjacent to each other
<hr>
<b>NOTE</b>: for sort repeated sequences (p.e. AA or AAA), no mismatches are available.
</body>
</html>